sali (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
98
Structured Review
New England Biolabs
sali
Sali, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 538 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sali+hf/SalI-HF/pm41876484-461-33-53
Average 98 stars, based on 538 article reviews
Sali, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 538 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sali+hf/SalI-HF/pm41876484-461-33-53
Average 98 stars, based on 538 article reviews
sali - by Bioz Stars,
2026-09
98/100 stars
Images
Related Articles
Amplification:Article Title: Single-cell CRISPR activation screens in primary B cells discover gene regulatory mechanisms for hundreds of autoimmune risk loci Article Snippet: The blasticidin resistance gene in LentiSAMv2 (a gift from Feng Zhang; Addgene #75112 ( )) was replaced with Cherry Fluorescent Protein (ChFP) by digesting LentiSAMv2 with BsrGI-HF (New England Biolabs, NEB) and EcoRI-HF (NEB) and replaced with the ChFP gene amplified from pLVX-EF1α-IRES-mCherry vector (Takara Bio 631987) to generate LentiSAMv2-ChFP . .. The subsequent dCas9-VP64-T2A-ChFP fragment was amplified and cloned into retroviral vector MSCV-BCL6-t2A-BCL2 (Addgene #135305; ( , )) digested with XhoI (NEB) and Clone Assay:Article Title: Single-cell CRISPR activation screens in primary B cells discover gene regulatory mechanisms for hundreds of autoimmune risk loci Article Snippet: The blasticidin resistance gene in LentiSAMv2 (a gift from Feng Zhang; Addgene #75112 ( )) was replaced with Cherry Fluorescent Protein (ChFP) by digesting LentiSAMv2 with BsrGI-HF (New England Biolabs, NEB) and EcoRI-HF (NEB) and replaced with the ChFP gene amplified from pLVX-EF1α-IRES-mCherry vector (Takara Bio 631987) to generate LentiSAMv2-ChFP . .. The subsequent dCas9-VP64-T2A-ChFP fragment was amplified and cloned into retroviral vector MSCV-BCL6-t2A-BCL2 (Addgene #135305; ( , )) digested with XhoI (NEB) and Retroviral:Article Title: Single-cell CRISPR activation screens in primary B cells discover gene regulatory mechanisms for hundreds of autoimmune risk loci Article Snippet: The blasticidin resistance gene in LentiSAMv2 (a gift from Feng Zhang; Addgene #75112 ( )) was replaced with Cherry Fluorescent Protein (ChFP) by digesting LentiSAMv2 with BsrGI-HF (New England Biolabs, NEB) and EcoRI-HF (NEB) and replaced with the ChFP gene amplified from pLVX-EF1α-IRES-mCherry vector (Takara Bio 631987) to generate LentiSAMv2-ChFP . .. The subsequent dCas9-VP64-T2A-ChFP fragment was amplified and cloned into retroviral vector MSCV-BCL6-t2A-BCL2 (Addgene #135305; ( , )) digested with XhoI (NEB) and Expressing:Article Title: Functional effects of EpCAM N-glycosylation in MDA-MB-468 breast cancer cells. Article Snippet: Generation of stable cell lines HEK293T cells were transfected with pLentiCRISPRv229 with EpCAM guide RNA30 (Genscript, Piscataway, NJ, USA), lentiviral packaging plasmid psPAX2 (courtesy of Didier Trono, Addgene #12260, Watertown, MA, USA), and envelope plasmid PMD2.G (courtesy of Didier Trono, Addgene #12259) using Lipofectamine 3000 (Thermo Fisher Scientific #L3000-008) according to the manufacturer’s instructions. .. To generate the EpCAM overexpressing (OV) and mutEpCAM expressing plasmids, custom genes were produced by Thermo Fisher Scientific GeneArt and inserted into pLentiCMV-blast31 (courtesy of Eric Campeau & Paul Kaufman, Addgene #17486) using restriction enzyme cloning with XbaI (New England Biolabs #R0145S) and Produced:Article Title: Functional effects of EpCAM N-glycosylation in MDA-MB-468 breast cancer cells. Article Snippet: Generation of stable cell lines HEK293T cells were transfected with pLentiCRISPRv229 with EpCAM guide RNA30 (Genscript, Piscataway, NJ, USA), lentiviral packaging plasmid psPAX2 (courtesy of Didier Trono, Addgene #12260, Watertown, MA, USA), and envelope plasmid PMD2.G (courtesy of Didier Trono, Addgene #12259) using Lipofectamine 3000 (Thermo Fisher Scientific #L3000-008) according to the manufacturer’s instructions. .. To generate the EpCAM overexpressing (OV) and mutEpCAM expressing plasmids, custom genes were produced by Thermo Fisher Scientific GeneArt and inserted into pLentiCMV-blast31 (courtesy of Eric Campeau & Paul Kaufman, Addgene #17486) using restriction enzyme cloning with XbaI (New England Biolabs #R0145S) and Cloning:Article Title: Functional effects of EpCAM N-glycosylation in MDA-MB-468 breast cancer cells. Article Snippet: Generation of stable cell lines HEK293T cells were transfected with pLentiCRISPRv229 with EpCAM guide RNA30 (Genscript, Piscataway, NJ, USA), lentiviral packaging plasmid psPAX2 (courtesy of Didier Trono, Addgene #12260, Watertown, MA, USA), and envelope plasmid PMD2.G (courtesy of Didier Trono, Addgene #12259) using Lipofectamine 3000 (Thermo Fisher Scientific #L3000-008) according to the manufacturer’s instructions. .. To generate the EpCAM overexpressing (OV) and mutEpCAM expressing plasmids, custom genes were produced by Thermo Fisher Scientific GeneArt and inserted into pLentiCMV-blast31 (courtesy of Eric Campeau & Paul Kaufman, Addgene #17486) using restriction enzyme cloning with XbaI (New England Biolabs #R0145S) and other:Article Title: Functional effects of EpCAM N-glycosylation in MDA-MB-468 breast cancer cells Article Snippet: After puromycin selection and a round of cell sorting with an Aria IIu Cell Sorter the Johns Hopkins Ross Flow Cytometry Core Facility using an anti-EpCAM antibody conjugated to Alexa Fluor 647 (1:200 dilution, Santa Cruz Biotechnology #sc25308-AF647, Dallas, TX, USA), the EpCAM knockout (KO) remained unstable, showing EpCAM expression to slowly increase again over time, indicating a mixed EpCAM KO and WT cell population. Polymerase Chain Reaction:Article Title: Optimized AAV Vector Enables Potent Therapeutic Rescue of Inherited Glycosylphosphatidylinositol Deficiency in Mice Article Snippet: Genotyping was performed as described previously; briefly, genomic DNA was extracted from mouse tail biopsies and amplified by polymerase chain reaction (PCR) using PrimeSTAR GXL Premix Fast DNA polymerase (Takara Bio) with the following primers. .. Primer 1: 5′TTGCCACCCTGGAAATGTTG3′ Primer 2: 5′TAGAGGTGTTCCAAGATGCCG3′ Primer 3: 5′CACATTTCCCCGAAAAGTGCCAC3′ PCR products were digested with Agarose Gel Electrophoresis:Article Title: Optimized AAV Vector Enables Potent Therapeutic Rescue of Inherited Glycosylphosphatidylinositol Deficiency in Mice Article Snippet: Genotyping was performed as described previously; briefly, genomic DNA was extracted from mouse tail biopsies and amplified by polymerase chain reaction (PCR) using PrimeSTAR GXL Premix Fast DNA polymerase (Takara Bio) with the following primers. .. Primer 1: 5′TTGCCACCCTGGAAATGTTG3′ Primer 2: 5′TAGAGGTGTTCCAAGATGCCG3′ Primer 3: 5′CACATTTCCCCGAAAAGTGCCAC3′ PCR products were digested with |