sali hf (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
98
Structured Review
New England Biolabs
sali hf
Sali Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 540 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sali+hf/SalI-HF/pm42789724-511-45-50
Average 98 stars, based on 540 article reviews
Sali Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 540 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sali+hf/SalI-HF/pm42789724-511-45-50
Average 98 stars, based on 540 article reviews
sali hf - by Bioz Stars,
2026-10
98/100 stars
Images
Related Articles
Amplification:Article Title: Single-cell CRISPR activation screens in primary B cells discover gene regulatory mechanisms for hundreds of autoimmune risk loci Article Snippet: The blasticidin resistance gene in LentiSAMv2 (a gift from Feng Zhang; Addgene #75112 ( )) was replaced with Cherry Fluorescent Protein (ChFP) by digesting LentiSAMv2 with BsrGI-HF (New England Biolabs, NEB) and EcoRI-HF (NEB) and replaced with the ChFP gene amplified from pLVX-EF1α-IRES-mCherry vector (Takara Bio 631987) to generate LentiSAMv2-ChFP . .. The subsequent dCas9-VP64-T2A-ChFP fragment was amplified and cloned into retroviral vector MSCV-BCL6-t2A-BCL2 (Addgene #135305; ( , )) digested with XhoI (NEB) and Clone Assay:Article Title: Single-cell CRISPR activation screens in primary B cells discover gene regulatory mechanisms for hundreds of autoimmune risk loci Article Snippet: The blasticidin resistance gene in LentiSAMv2 (a gift from Feng Zhang; Addgene #75112 ( )) was replaced with Cherry Fluorescent Protein (ChFP) by digesting LentiSAMv2 with BsrGI-HF (New England Biolabs, NEB) and EcoRI-HF (NEB) and replaced with the ChFP gene amplified from pLVX-EF1α-IRES-mCherry vector (Takara Bio 631987) to generate LentiSAMv2-ChFP . .. The subsequent dCas9-VP64-T2A-ChFP fragment was amplified and cloned into retroviral vector MSCV-BCL6-t2A-BCL2 (Addgene #135305; ( , )) digested with XhoI (NEB) and Article Title: A designed ubiquitin-binding protein selectively enriches and visualizes unanchored ubiquitin. Article Snippet: .. To finalize the library, the missing part of the backbone containing the downstream region of the barcode landing pad, the CYC promoter for the prey cassette, and the FR fragment with 3× Flag tag and linker had to be cloned into the plasmid libraries using Retroviral:Article Title: Single-cell CRISPR activation screens in primary B cells discover gene regulatory mechanisms for hundreds of autoimmune risk loci Article Snippet: The blasticidin resistance gene in LentiSAMv2 (a gift from Feng Zhang; Addgene #75112 ( )) was replaced with Cherry Fluorescent Protein (ChFP) by digesting LentiSAMv2 with BsrGI-HF (New England Biolabs, NEB) and EcoRI-HF (NEB) and replaced with the ChFP gene amplified from pLVX-EF1α-IRES-mCherry vector (Takara Bio 631987) to generate LentiSAMv2-ChFP . .. The subsequent dCas9-VP64-T2A-ChFP fragment was amplified and cloned into retroviral vector MSCV-BCL6-t2A-BCL2 (Addgene #135305; ( , )) digested with XhoI (NEB) and FLAG-tag:Article Title: A designed ubiquitin-binding protein selectively enriches and visualizes unanchored ubiquitin. Article Snippet: .. To finalize the library, the missing part of the backbone containing the downstream region of the barcode landing pad, the CYC promoter for the prey cassette, and the FR fragment with 3× Flag tag and linker had to be cloned into the plasmid libraries using Plasmid Preparation:Article Title: A designed ubiquitin-binding protein selectively enriches and visualizes unanchored ubiquitin. Article Snippet: .. To finalize the library, the missing part of the backbone containing the downstream region of the barcode landing pad, the CYC promoter for the prey cassette, and the FR fragment with 3× Flag tag and linker had to be cloned into the plasmid libraries using Polymerase Chain Reaction:Article Title: Optimized AAV Vector Enables Potent Therapeutic Rescue of Inherited Glycosylphosphatidylinositol Deficiency in Mice Article Snippet: Genotyping was performed as described previously; briefly, genomic DNA was extracted from mouse tail biopsies and amplified by polymerase chain reaction (PCR) using PrimeSTAR GXL Premix Fast DNA polymerase (Takara Bio) with the following primers. .. Primer 1: 5′TTGCCACCCTGGAAATGTTG3′ Primer 2: 5′TAGAGGTGTTCCAAGATGCCG3′ Primer 3: 5′CACATTTCCCCGAAAAGTGCCAC3′ PCR products were digested with Agarose Gel Electrophoresis:Article Title: Optimized AAV Vector Enables Potent Therapeutic Rescue of Inherited Glycosylphosphatidylinositol Deficiency in Mice Article Snippet: Genotyping was performed as described previously; briefly, genomic DNA was extracted from mouse tail biopsies and amplified by polymerase chain reaction (PCR) using PrimeSTAR GXL Premix Fast DNA polymerase (Takara Bio) with the following primers. .. Primer 1: 5′TTGCCACCCTGGAAATGTTG3′ Primer 2: 5′TAGAGGTGTTCCAAGATGCCG3′ Primer 3: 5′CACATTTCCCCGAAAAGTGCCAC3′ PCR products were digested with |